Guidelines for Authors

Editorial Policies, including Availability of Materials/Data, Peer Review and Open Access

Editorial Policy

When a manuscript is submitted, the Editors assume that no similar paper has been or will be submitted for publication elsewhere. Further, it is understood that all authors listed on a manuscript have agreed to its submission. Upon acceptance, authors must sign a License to Publish. Should the authors choose to have their paper freely available, then the Open Access License Agreement must be signed and will replace the License to Publish (please see the Landes Bioscience Open Access Policy for further details.

Manuscripts should conform to the Uniform Requirements for Manuscripts Submitted to Biomedical Journals (URMSBJ), which can be found in full at www.icmje.org. This is in addition to their need to conform to our general guidelines about layout, etc. In particular, the attention of authors is drawn to the following conditions (which are extracted from the URMSBJ):

Authorship
Authorship credit should be based on 1) substantial contributions to conception and design, or acquisition of data, or analysis and interpretation of data; 2) drafting the article or reviewing/revising it critically for important intellectual content and 3) final approval of the version to be published. Each authors should meet all three of these criteria. Acquisition of funding, or general supervision of a research group, are not valid criteria for authorship. Individuals who have a lesser involvement should be thanked in the acknowledgements. If meeting these requirements causes problems for a particular manuscript, authors are encouraged to contact the Editor-in-Chief for advice on alternative ways other contributors can be listed.

Acknowledgment of Funding
Authors should list all sources of funding for the research described in a manuscript in the 'Acknowledgments' section.

Conflict of Interest
Potential conflicts of interest exist when an author or reviewer has financial or personal interests in a publication that might, in principle, influence their scientific judgment. Financial interests include, but are not limited to, stock-holding, consultancy, paid expert testimony and honoraria; they also include any limitations on freedom to publish that are imposed on an author by an employer or funding agency. In order to encourage transparency without impeding publication, authors are required to include a statement at the end of a manuscript that lists all potential financial interests or, if appropriate, that clearly states that there are none. Possible conflicts of interest of a personal nature should also be communicated to the Editor-in-Chief, who will discuss with the author whether these ought to be listed. Peer reviewers are also required to inform the Editor-in-Chief of any potential conflicts of interest, financial or otherwise.

Ethical Statements
If a study involves any ethical issues, which include patient confidentiality and treatment of animals, the paper must be accompanied by a statement to the effect that the authors complied with all of the legal requirements pertaining to the location(s) in which the work was done.
Indicate whether the procedures were approved by the Ethics Committee of Human Experimentation in your country, or are in accordance with the Helsinki Declaration of 1975.

Corrections and retractions
Authors are obliged to notify the Editor-in-Chief at once if they find that a published manuscript contains an error, plagiarism or fraudulent data. The journal will publish a correction, retraction or notice of concern at the earliest possible date: authors are encouraged to contact the Editor-in-Chief to discuss the most appropriate course of action.

Duplicate or redundant publication
We only publish original manuscripts that are not also published or going to be published elsewhere.
Duplicate publications, or redundant publications (re-packaging in different words of data already published by the same authors) will be rejected. If  detected after publication, the Editor reserves the right to publish a notice of the fact without requiring the authors' approval. Competing manuscripts on the same study, for example by collaborators who have split into rival teams after the data were gathered, are acceptable only under special circumstances: please contact the Editor-in-Chief for advice.

Plagiarism and other fraud
If the Editor has reason to suspect that a manuscript is plagiarized or fraudulent, he or she reserves the right to bring his concerns to the authors' sponsoring institution and any other relevant bodies. 

Upon submission all manuscripts go through a rigorous quality control check that includes evaluation by Ithenticate to identify any previously published phrases. Authors should pay particular attention to the originality of their work. 

Limits to freedom of expression
We are committed to academic freedom. It does, however, have to operate within the laws of the USA, where it is published. Although a liberal democracy that is committed to academic freedom, it does have certain legal restrictions on the publication of specific types of material (for example, defamation of character, incitement to racial hatred, material intended to aid terrorism, etc.). In the unlikely event that a manuscript contains material that contravenes these restrictions, the journal reserves the right to request that the material is removed from the manuscript or that the manuscript is withdrawn. In any case, the journal requires authors to take full legal responsibility for what they have written.

Ithenticate
Landes Bioscience uses iThenticate to screen for plagiarism before publication. The iThenticate software checks submissions against millions of published research papers, documents on the web, and other relevant sources. Authors, researchers and freelancers can also use the iThenticate system to screen their work before submission by visiting research.ithenticate.com.


Availability of Materials and Data
It is expected that authors should be able to provide any materials and/or protocols used in published experiments to other qualified researchers for their own use. Materials include (but are not limited to): cells DNA, antibodies, reagents, organisms, mouse strains, and Drosophila strains. These should be made available in a timely manner and it is acceptable to request reasonable payment to cover the cost of maintenance and transport. 



For materials such as mutant strains and cell lines, authors should use established public repositories and provide relevant accession numbers wherever possible. 



Repositories include:



 

Papers reporting protein or DNA sequences and molecular structures should provide an accession number to any of the three major collaborative databases: DDBJ, EMBL or GenBank. It is only necessary to submit to one database as data are exchanged between DDBJ, EMBL and GenBank on a daily basis. The suggested wording for referring to accession-number information is: 'These sequence data have been submitted to the DDBJ/EMBL/GenBank databases under accession number U12345.'


Peer Review
Each contribution is typically vetted by at least two expert reviewers who are either members of the Editorial Board or are recruited by Board members.

For original articles or short reports, reviewers will generally be asked to comment on the following aspects of the submitted manuscripts:

  • •   significance to the field
  • •   study of data
  • •   quality of data
  • •   quality of controls
  • •   whether conclusions are justified
  • •   whether the effects are meaningful
  • •   whether the study is described clearly
  • •   the novelty of the work


If the reviewers believe the paper is potentially acceptable, but could be improved, specific suggestions will be made for improvement.

Final acceptance of all submitted manuscripts is a decision made by the Editor(s) in consultation with the Editorial Board and reviewers. If a manuscript does not meet the standards of the journal or is otherwise lacking in scientific rigor or contains major deficiencies, the reviewers will attempt to provide constructive criticism to assist the authors in ultimately improving their work for publication, here or elsewhere. Manuscripts not invited for resubmission will not be reconsidered.

If a manuscript receives favorable reviews but is not accepted outright following the initial review, it may be invited for reconsideration with the expectation that the authors will fully address the reviewer’s criticisms. Resubmitted manuscripts with major revisions will be sent back for peer review.

Accepted papers will be rapidly posted to the journal website as an E-publication (ahead of print).


Open Access Policy

Landes Bioscience recognizes that an increasing number of research-funding agencies require agency-funded research be deposited in public repositories.  It is our mission to help authors comply with the following 2 options: 

(1) ONE year after publication, ALL papers will become open access to ALL users throughout the world. Full-text XML will be deposited to PMC and UKPMC by the publisher.

(2) Authors may pay to have their paper freely available online IMMEDIATELY upon publication. Authors who choose to pay for open access will be asked to sign an Open Access License Agreement, which requires the author to license the work under a Creative Commons Attribution-NonCommercial 3.0 Unported License, which allows unrestricted NON-COMMERCIAL use, distribution and reproduction, provided the original source is properly cited. 

Landes Bioscience Open Access License Agreement

Once a manuscript has been accepted for publication, authors may let the Managing Editor know that they wish to purchase open access for their paper.  Otherwise, all authors will receive an order form with their galley proofs. It is $750 for original research papers and reports and $500 or all other types of papers. The open access fee does not replace any existing publication costs.

Authors who choose to pay the optional open access fee to have their papers freely available online immediately upon publication agree to license their manuscript under a Creative Commons Attribution-NonCommercial 3.0 Unported License. With this license, authors retain the copyright to their work. This license also allows users to copy, distribute, transmit and adapt the work for non-commercial (educational and research) purposes.  It only requires that users attribute the original authorship as well as the journal and publisher as the original source with proper citation details. Commercial rights are protected by Landes Bioscience.

Landes Bioscience Open Access Agreement

Creative Commons Attribution Noncommercial License

Creative Commons Attribution Noncommercial License – Full Legal Code

Compliance with Funding Agencies

All manuscripts that are agency-funded (e.g., NIH, HHMI, Wellcome Trust, etc.) AND paid for under the Open Access License Agreement will be automatically deposited and made publicly available in PubMed Central by the publisher. Agency-funded articles that are NOT open access will be deposited by the publisher and publicly available in PubMed Central (and UKPMC) within 6-12 months of publication, depending on the agency's public access policy.  

Author Self-Archiving

Authors are entitled to deposit a final version of their manuscript in their institution's repository immediately upon publication.  Again, we only require that a link to the published version at the journal's website is included, along with attribution to the journal as the original source (with full citation details). 


Manuscript Submission

Online Submission
RNA Biology utilizes an online submission and tracking system designed to provide a better, more efficient service to authors.
•   Authors can submit manuscripts online from anywhere in the world.
•   Authors can track their manuscript through the peer review process.
•   Author files are automatically converted into a PDF (Portable Document Format) file and submissions are acknowledged by email.
•   Editors and reviewers access the PDF files on the website.

Click here to submit your manuscript to RNA Biology.

Previously Submitted
RNA Biology recognizes that excellent papers may have been erroneously rejected by other journals. We will reconsider papers that have been rejected by Nature, Science, Nature Medicine, Nature Cell Biology, Cell, Cancer Cell, Cell Metabolism, Developmental Cell, NEJM, Lancet, Genes & Development and some other journals in the original format of those journals, thus saving the authors effort and time. Authors are encouraged to enclose the reviewers' and/or editorial comments from the journals mentioned above. This will expedite the evaluation of the article. In some instances, the article may be accepted based on the previous review. This allows urgent and competitive research to be published soon after submission. Papers submitted using the Select Submission Track can be accepted within 1-2 days.

Please submit your paper and contact the Editor-in-Chief with the manuscript number and a PDF with the previous review. Upon acceptance, authors should provide the paper in RNA Biology’s format.

Pre-submission inquiries
Pre-submission inquiries are not necessary but are welcome. These may include either an abstract or a full-length manuscript as an email attachment (Microsoft Word). Pre-submission inquiries should be emailed to the Editor-in-Chief (Renee Schroeder).

Non-Native Speakers of English
Authors who are not native speakers of English and submit manuscripts to international journals, often receive negative comments from referees or editors about English-language usage. These problems can contribute to a decision to reject a paper. To help reduce the possibility of such problems, we strongly encourage such authors to take at least one or both of the following steps:

  • Have your manuscript reviewed for clarity by a colleague whose native language is English.
  • Use a service such as one of those listed at the end of our guidelines. An editor will improve the English to ensure that your meaning is clear and identify problems that require your review. Note that the use of such a service is at the author's own expense and risk, and does not guarantee that the article will be accepted. Landes Bioscience accepts no responsibility for the interaction between the author and the service provider or for the quality of the work performed.

Manuscript Preparation

Types of Papers

Research Papers/Reports
Research Papers or Reports should include the following sections in the following order:

  • Abstract: A single paragraph of fewer than 250 words. The primary goal of the abstract should be to make the general significance and conceptual advance of the work clearly accessible to a broad readership. References should not be cited in the abstract.
  • Key words: Include 5-10 for indexing purposes.
  • Introduction.
  • Results: Present results in a logical sequence in tables and illustrations. In the text, explain, emphasize or summarize the most important observations. Units of measurement should be expressed in accordance with Systeme International d'Unites (SI Units).
  • Discussion: Do not repeat in detail data given in the Results section. Emphasize the new and important aspects of the study. Relate observations to other relevant studies. On the basis of your findings (and others'), discuss possible implications/conclusions. When stating a new hypothesis, clearly label it as such.
  • Patients and Methods/Materials and Methods: Describe the selection of patients or experimental animals, including controls. Do not use patients' names or hospital numbers. Identify methods, apparatus (manufacturer's name and address) and procedures in sufficient detail to allow other workers to reproduce the results. Provide references and brief descriptions of methods that have been published. When using new methods, evaluate their advantages and limitations. Identify drugs and chemicals, including generic name, dosage and route(s) of administration.
  • Indicate whether the procedures were approved by the Ethics Committee of Human Experimentation in your country, or are in accordance with the Helsinki Declaration of 1975.
  • For reagents listed in the Materials and Methods section, the company that supplied the reagent and the catalog number should be listed in parentheses; do not list the company location.
  • References: No more than 85.
  • Figure legends.
  • Tables: Tables should be numbered consecutively with Arabic numerals and include descriptive titles and legends.

 

Technical Paper 
Technical Papers contain original research, however, they differ from Research Papers in that they describe new approaches, methods, or reagents rather than new understanding of a natural molecule or biological process. Papers may be submitted as either Technical or Research Papers, but the assignment to either category is the discretion of the Editors. All submissions will be peer reviewed.

Perspectives
For Perspectives, the Editorial Board will solicit authors of the most significant recent and forthcoming papers, published elsewhere, to provide a short summary with additional insights, new interpretations or speculation on the relevant topic. These manuscripts may include data or models which, due to space limitations, were not included or discussed in the original paper. In other words, the authors may provide biased and uncensored points of view, complementing their article. As with other papers published in RNA Biology, Perspectives will appear online and in print shortly after publication of the original paper. 

Please include an abstract of 150-200 words and 5-10 key words for indexing purposes.

Meeting Reports
Meeting Reports are summaries of presentations from recent meetings in the field. Authors are encouraged to contact the Editor-in-Chief with proposals for meeting reports. Also, please contact the meeting organizers to verify that reports will be permitted. Please include an abstract of 150-200 words and 5-10 key words for indexing purposes.

Letters to the Editor
Letters to the Editor are aimed at publishing short, but important, breakthrough data not embedded within a complex story. This can also be what is considered a Small Publishable Unit. In other words, data that is sufficient in itself to be published, but not a part of a larger story that would comprise an entire research article.

Letters to the Editor can also be mini-reviews with an small addition of novel data.
 
The abstract should not be longer than 120 words. The paper should be structured as a research paper (see above), but without the headings and subheadings. No more than 50 references and no more than 4,500 words altogether.
 

Reviews
Reviews should be recognized as scholarly by specialists in the field being covered, but should also be written with a view to informing readers who are not specialized in that particular field, and should therefore be presented using simple prose. Please avoid excessive jargon and technical detail. Reviews should capture the broad developments and implications of recent work. The opening paragraph should make clear the general thrust of the review and provide a clear sense of why the review is now particularly appropriate. The concluding paragraph should provide the reader with an idea of how the field may develop or future problems to overcome, but should not summarize the article. To ensure that a review is likely to be accessible to as many readers as possible, it may be useful to ask a colleague from another discipline to read the review before submitting it. Submitted reviews are subject to the same page charges as full-length reports—whether and how page charges will apply for commissioned reviews will be determined upon each comission. Reviews should include an abstract of 150 words and should cite no more than 150 references. Please include 5-10 key words for indexing purposes.

Point-of-View
Point-of-View articles should follow the same general guidelines as reviews, however there is considerable flexibility in the length and content. These articles are intended to address controversial issues, express new ideas, or expand on work already published. They may contain new data, and like other submissions, are subject to peer review. Like review articles, they should be accessible to a wide readership. Point-of-View articles are generally commissioned from authors of the most important recent papers to offer additional insights. Unsolicited Point-of-View articles are also welcome, and these may discuss the authors' own work or recent significant work in their field. These should be structured like reviews and be 1,500 to 2,500 words. Responses to Point-of-View articles are encouraged and will also be published as Point-of-View articles. Responses may be considerably shorter and structured as letters. Please include an abstract of 150 words.

Commentaries
For Commentaries, the Editorial Board will solicit authors of the most significant recent and forthcoming papers, published elsewhere, to provide a short summary with additional insights, new interpretations or speculation on the relevant topic. These manuscripts may include data or models which due to space limitations were not included or discussed in the original paper. In other words, the authors may provide biased and uncensored points of views, complementing their article.


Please include an abstract of 150-200 words, 5-10 key words for indexing purposes. No more than 50 references, please.

Guidelines for the RNA Families Track
This track will primarily publish articles describing either: (1) substantial updates and reviews of existing RNA families or (2) novel RNA families based on computational and/or experimental results for which little evolutionary analysis has been published. These articles must be accompanied by STOCKHOLM formatted alignments, including a consensus secondary structure or structures and a corresponding Wikipedia article. Publication in the track will require a short manuscript, a high quality Stockholm alignment and at least one Wikipedia article; each centered around the RNA in question.
 
Writing the manuscript:
The article itself should adhere to the format: Abstract, Introduction, Results, Discussion, Materials and Methods and Supplementary Material.
The Introduction should give an overview of the family detailing how and when the original members were identified, what is the function (if known) of the family and what was previously known about the taxonomic distribution of the family.
The Results section should discuss the new homologues (distinguishing paralogues and orthologues) found in the study, as well as the taxonomic distribution and evolutionary conservation of the families sequence and structure. Suggested figures are secondary structure diagrams, alignments (of the smaller families), phylogenetic trees and sequence logos.
The Conclusions/Discussion section should not repeat in detail data given in the Results section. Emphasize the new and important aspects of the study. Relate observations to other relevant studies. On the basis of your findings (and others’), discuss possible implications/conclusions. 
The Materials and Methods section should detail: the sources of seed sequences and structures; the methods and tools used for homology searches, alignments and secondary structure predictions; the sequence databases searched. Correct version numbers and references should be given where relevant.
 
To be eligible for publication the Supplementary Material must contain:
(1) a link to a Wikipedia article preferably in a User's space. Upon acceptance, this can easily be moved into Wikipedia itself together with a reference to the published article.
(2) a plain text Stockholm formatted file containing an alignment and consensus secondary structure for the family.
 
Formatting your Stockholm alignment:
 
The quality and consistency of the submitted alignment will be of primary importance for publication in the RNA families track.
 
The minimal requirements for a Stockholm alignment are:
(1) A header line eg. '# STOCKHOLM 1.0'.
(2) At least two sequences, each preceded with a unique plain-text sequence ID.
(3) A secondary structure line, preceded with the tag '#=GC SS_cons ', followed by a secondary structure string. Consensus basepairs are represented by matching parentheses, any of '({[<>]})' type parentheses are acceptable. Unpaired sites can be indicated by any of the characters '.,;'. Pseudoknots should be marked-up by matching upper and lower case english alphabet characters. The 5' nucleotide within the knot should be in uppercase and the 3' nucleotide lowercase. 
(4) A footer line indicating the end of alignment eg. '// '.
 
Ideally the alignment will be marked up with information distinguishing between experimentally validated seed sequences and computationally determined homologs. The sources and relevant identifiers of each sequence can
also be documented. These additional pieces of information can be added using '#=GS <seq_id> <tag> <freetext>' 
tags.
See the Infernal userguide and/or http://en.wikipedia.org/wiki/Stockholm_format for more information. Also, there are a few useful tools for dealing with Stockholm alignments:
-sreformat is useful for converting between different formats.
-Ralee is a handy alignment editor that supports (RNA) Stockholm format.
-Infernal and HMMer both accept Stockholm formats for homology search and alignment.
 
# STOCKHOLM 1.0
#=GS tym_vir1 CC EMBL_ID: AF035635.1/619-641 Turnip yellow mosaic virus unpublished
#=GS tym_vir2 CC EMBL_ID: M24804.1/82-104 Turnip yellow mosaic virus unpublished
#=GS tym_vir3 CC EMBL_ID: J04373.1/6212-6234 Turnip yellow mosaic virus published # REF: Virology. 2004
Mar 30;321(1):36-46.
#=GS tym_vir4 CC EMBL_ID: M24803.1/1-23 Turnip yellow mosaic virus unpublished
tym_vir1 UGAGUUCUCGAUCUCUAAAAUCG
tym_vir2 UGAGUUCUCUAUCUCUAAAAUCG
tym_vir3 UAAGUUCUCGAUCUUUAAAAUCG
tym_vir4 UAAGUUCUCGAUCUCUAAAAUCG
#=GC SS_cons .AAA....<<<<aaa....>>>>
//
 
A short guide to creating your first Wikipedia article:
 
At least one stub article (essentially an extended abstract) for the paper should be added to either an author's userspace at Wikipedia (preferred route) or added directly to the main Wikipedia space (be sure to add literature references to avoid speedy deletion). This article will be reviewed alongside the manuscript and may require revision before acceptance. Upon acceptance, the former articles can easily be exported to the main Wikipedia space. See below for guidelines on how to do this. Existing articles can be updated in accordance with the latest published results.
 
1. Create an account for yourself at Wikipedia. Go to your favorite Wikipedia article e.g. http://en.wikipedia.org/wiki/RNA and click on the "Log in / create account" link at the top of the page; Follow the instructions for creating an account for yourself.
 
2. Once you have logged in you can go to your userpage by clicking on your username at the top of the page (Paul Gardner's for example takes him to the URL  ttp://en.wikipedia.org/wiki/User:Ppgardne). You can personalize this page as you like. To create your stub article, simply add "/name_of_RNA_family" to the URL. For example, if you wanted to create an article about the new eRNA family, you would visit the URL http://en.wikipedia.org/wiki/User:Ppgardne/eRNA. Click on the option "Start the User:Ppgardne/eRNA  age" and then add the content that you would like to appear in the article to the text box. You can view previews of the article as you work; do not forget to push save once you are happy with the article. 
  • An excellent option for inexperienced users is to write a draft of the article using OpenOffice (version 2.3 or greater). OpenOffice can export content directly in WikiMedia format!
  • Keep in mind that Wikipedia articles are to be targeted at a level that an undergraduate could comprehend. Try to avoid jargon and do provide links to other Wikipedia articles at the first use of specific terms, e.g. [[RNA]]. Also the title of the page should appear in bold at the first use of the text of the article, e.g. "eRNA."

 

3. References can be generated in Wikipedia format using the template filler tool. Add these at end of relevant sentences within the text after punctuation points.
 
4. To get a nicely formatted reference list at the bottom of the page just add the following two lines:
==References==
{{reflist|2}}
 
Take note to ensure that any uploaded figures conform to Wikipedia's image use policy (http://en.wikipedia.org/wiki/Wikipedia:Image_use_policy)

Organization
All manuscripts should be in English. Please ensure that manuscripts are clear, concise and grammatically correct.

Text should be prepared in MS Word, double-spaced, with page numbers throughout.
Organize manuscripts in the following manner:

  • •   Title page, including titles, author's names (first, MI, last) and affiliations
  • •   5-10 key words (for indexing purposes)
  • •   A list of abbreviations and acronyms used throughout the text
  • •   An abstract (please see Type of Paper for word limit), the primary goal of which is to make the general significance and conceptual advance of the work clearly accessible to a broad readership. (References should not be cited in the abstract.)
  • •   Text (length and organization depends upon type of paper)
  • •   Acknowledgments
  • •   References
  • •   Figure legends
  • •   Tables (with descriptive titles and legends)


There are no word limits for papers published, however, accepted manuscripts are published with the understanding that page and color charges will be assessed. Please see the section, Page and Color Charges below.

If your paper is to be published in a journal indexed by PubMed/Medline, the citation of your article will be sent to PubMed within one week of acceptance; therefore, please ensure that all information is correct.


Text Files and Tables
Please save text and table files as MS Word documents. Figure legends should be at the end of the manuscript following references. Tables will be reformatted during production and therefore should only be minimally formatted in your text file and follow the figure legends.


Figures
Figures should be as small and simple as clarity permits. Unnecessary figures and panels in figures should be avoided: data presented in small tables or histograms, for instance, can generally be stated briefly in the text instead. Avoid unnecessary complexity, coloring and excessive detail. Figures should not contain more than one panel unless the parts are logically connected. Where possible, text, including keys to symbols, should be provided in the text of the figure legend rather than on the figure itself. Any image processing should be explained clearly in the Materials and Methods section of your manuscript.

To aid in the processing and turnaround of issues, we ask that authors please adhere to the following figure guidelines. Authors will be asked to revise details and images if they do not adhere to the figure protocols.

Guidelines for Figure Preparation

Image presentation
(These guidelines for image presentation are adapted from the “Instructions for Authors” that are posted on the Journal of Cell Biology web site, and are included here with permission).

As you prepare your figures, please adhere to the following guidelines to accurately present your data:

1. No specific feature within an image may be enhanced, obscured, moved, removed, or introduced. 

2. The grouping of images from different parts of the same gel, or from different gels, fields, or exposures must be made explicit by the arrangement of the figure (i.e., using dividing lines) and in the text of the figure legend. 

3. Adjustments of brightness, contrast, or color balance are acceptable if they are applied to the whole image and as long as they do not obscure, eliminate, or misrepresent any information present in the original, including the background. Non-linear adjustments must be disclosed in the figure legend.

A more detailed discussion of image presentation can be found at the following URL: http://jcb.rupress.org/content/166/1/11.full (Rossner and Yamada, J. Cell Biol. 166:11–15)

Resolution
All submitted images must be of high quality and have resolutions of 300 dpi ready for print.

Formats
We require figures in electronic format. Please do not send PowerPoint, MS Word, presentation, or paint files as they are inadequate for the creation of high quality images. Much of the information contained in PowerPoint or other file types is lost or skewed in the conversion of images. Figures should be provided as TIFF, Photoshop, EPS or high resolution PDF files. Compatible graphic art programs are Adobe Illustrator and Adobe Photoshop.

Figure size
Figures should be submitted at the size they are to be published. Maximum width = 7.1 in. Maximum height = 9.5 in.

For multi-panel figures (such as figure 1a, 1b, 1c, etc), each panel should be assembled into one image file. Do not include separate panels on multiple pages, i.e. A, B, C and D should all fit on one page. Each panel should be sized so that the figure as a whole can be reduced by the same amount and reproduced on the printed page at the smallest size at which essential details, including type, are visible and readable.

Color mode
Save all color figures in CMYK mode at 8 bits/channel. Layering type directly over shaded or textured areas and using reversed type (white lettering on a colored background) should be avoided.

Type
Please be sure to embed all fonts. Use a sans serif font such as Helvetica. The font size should be no greater than 9 pt. and no smaller than 6 pt; however, panel labels (A, B, C) should be 15 pt. uppercase (not bold). Lettering in figures (labeling of axes and so on) should be in lowercase type, with the first letter capitalized and no full stop. Please keep font size relatively the same throughout the figures so as to avoid scaling issues. Also note that readability suffers if type is layered over a pattern or color other than white or black.

Units
Units should have a single space between the number and the unit, and follow SI nomenclature or the nomenclature common to a particular field. Thousands should be separated by commas (1,000). Unusual units or abbreviations should be defined in the legend. Please use the proper microsymbol (denoting a factor of one millionth) rather than a lower case u.


References
Include in the reference list only those articles that have been published or are in press. Unpublished data or personal communications must be cited within the text.

Please use "et al." after listing the first six authors. Do not use "et al." if there are less than six authors.

The list of references should be numbered consecutively according to the first time mentioned within the article. Cite only the number assigned to the reference:

Correct: according to Jones.1
Incorrect: according to Jones1.
Correct: noted by Smith et al.1
Incorrect: Smith et al (1).

 

When referring the reader to specific references as part of a sentence please state:

Correct: For a review see refs. 20-25.
Incorrect: For a review see 20-25


Journal References

  • •   The reference format is the same for all of our journals. You may download the output style for Cell Cycle from Endnotes.
  • •   Abbreviate journal names according to the style used in Index Medicus or a comparable source and omit punctuation after journal titles. Spell out foreign or less commonly known journal names.
  • •   [Author's last name] [Author's initials], [First six author's last names followed by their initials]. [Title of article with only the first word capitalized]. [Journal's standard abbreviated name] [Year]; [Volume (number)]:[Inclusive pages]; [PMID]; [DOI].
    • ∗ For Example:
      • ° Moore GL, Chen H, Karki S, Lazar GA. Engineered Fc variant antibodies with enhanced ability to recruit complement and mediate effector functions. mAbs 2010; 2:181-9.
      • ° Abrams SL, Steelman LS, Shelton JG, Wong EWT, Chappell WH, Basecke J, et al. The Raf/MEK/ERK pathway can govern drug resistance, apoptosis and sensitivity to targeted therapy. Cell Cycle 2010; 9:1781-91.
      • °   Plank C, Oberhauser B, Mechtler K, Koch C, Wagner E. The influence of endosome-disruptive peptides on gene transfer using synthetic virus-like gene transfer systems. J Biol Chem 1994; 269:12918-24.
      • °  Kotzamanis G, Abdulrazzak H, Gifford-Garner J, Haussecker PL, Cheung W, Grillot-Courvalin C, et al. CFTR expression from a BAC carrying the complete human gene and associated regulatory elements. J Cell Mol Med 2009; 13:2938-48.

Book References
  • •   [Author's last name] [Author's initials], [Other authors' last names followed by initials]. [Chapter title]. In: [Editor's last name] [Editor's initials], ed(s). [Book Title]. [Number of edition]. [City]:[Publisher], [Year]:[Inclusive pages].
    • ∗ For Example:
    • ° Ozoren N, El-Diery WS. Introduction to cancer genes and growth control. In: Ehrlic M, ed. DNA Alterations in Cancer: Genetic and Epigenetic Changes. Natick, MA: Eaton Publishing, 2000:3-43.

Supplementary Files
The following fees apply for any supplementary material posted with a manuscript. A $100 fee is assessed for all text, figures and/or tables. Supplementary movies carry a rate of $150 for the first five movie files and $50 for each subsequent movie file. Fees will be outlined on the publication charge form authors receive with galley proofs.

Please provide supplementary material in the following formats:

  • •   Text: MS Word file
  • •   Table/Data: MS Word file or Excel file
  • •   Figures: Please provide figures in a MS Word file or in a PPT file, clearly labeled with figure legends below them.
  • •   Video Files: Video submissions for viewing online should be Audio Video Interleave (.avi), MPEG (.mpg), or Quick Time (.qt, .mov).

    • °   AVI files can be displayed via Windows Media Player (http://www.microsoft.com/windows/windowsmedia/players.aspx); MPEG files can be displayed via Windows Media Player; Quick Time files require Quick Time software (free) from Apple (http://www.apple.com/quicktime/download/index.html)
    • °   Videos should be brief whenever possible (<2-5 minutes). Longer videos will require longer download times and may have difficulty playing online. Videos should be restricted to the most critical aspects of your research. A longer procedure can be restructured as several shorter videos and submitted in that form.
    • °   It is advisable to compress files to use as little bandwidth as possible and to avoid overly long download times. Video files should be no larger than 5 megabytes. This is a suggested maximum. If files are larger, please contact the Managing Editor.
    • °   A caption giving a brief overall description of the video content should be provided for each video.
    • °   If your paper is accepted for publication you may wish to supply the editorial office with several different resolutions of your video files. This will allow viewers with slower connections to download a lower resolution version of your video.
    •  

Please also provide ALL files in one PDF file. Links to supplementary data will be included in the PDF of the published manuscript and in the online abstract.


Cover Image Submissions
RNA Biology publishes cover illustrations that are taken from articles in each issue, or that are designed to accompany an accepted article.

The cover illustration should be scientifically interesting and visually attractive. The illustration need not be a figure from the paper, but should be closely related to the subject of the paper. If you are interested in submitting a figure for use as the cover of RNA Biology, please email a high-resolution version of your image, conforming to the specifications below, and an explanatory caption of 50-60 words to the Managing Editor

All potential cover images should be sized to fit on a singler letter size (8.5" x 11") page. Please remove all text, captions, etc. from the image. If you have variations of the image, you may send additional files. Please send no more than two alternate versions.

Accepted formats and resolution:
•   PSD (Adobe Photoshop: if graphics are built with layers, do not flatten), 300 dpi, CMYK at 100% size.
•   TIF, 300 dpi, CMYK at 100% size
•   JPG, 300 dpi highest quality, CMYK at 100% size.
•   EPS (scalable vector line art)
•   AI (Adobe Illustrator)


Publication Charges, Page Proofs and Ordering Reprints

Publication Charges

Page Charges
Page charges apply at a rate of $100 per page or partial page used for articles classified as Reports, Research Papers, Technical Papers, Brief Reports and Short Communications.

Color Charges
Please note that color charges are assessed separately from page charges and will be added to the total amount of page charges assessed. Publication of color images is free for the online version of the journal, but carries a page charge of $340 for the first page and $150 for each additional page in the print edition. Authors may choose to convert color images to grayscale for the print edition of their manuscript in order to eliminate color charges. If this option is selected, authors should provide replacement figure legend text at the galley proof stage if the original legends contain references to color.

Supplementary File Charges

Supplementary fees apply for any supplementary material posted with a manuscript. A $100 fee is assessed for all text, figures and/or tables. Supplementary movies carry a rate of $150 for the first five movie files and $50 for each subsequent movie file.

Under exceptional circumstances, where there are no funds to cover page charges and articles cannot be reduced in size, authors may appeal directly to the Editor for page charges to be waived. This appeal must be supported by a letter signed by a finance official at the author’s institution, confirming that no funds are available to cover page charges.

Page Proofs
Page proofs will be sent to the author via email. Page proofs should be returned within two working days, preferably by email. Corrections should be marked on the actual proof and provided in a numbered list. Lengthy additions should be avoided, but where necessary should be provided in a MS Word file, with explicit instructions regarding placement.

Reprints/Pre-Prints
A reprint and pre-print order form will be sent, along with an outline of publication charges, to authors via email with page proofs.


Services for Non-Native English Speakers

American Journal Experts

American Journal Experts

American Journal Experts (AJE) provides professional language editing services to authors around the globe who wish to publish in scientific, technical, medical and humanities journals. AJE employs expert editors with post-graduate training in a wide variety of fields who will check your manuscripts not only for terminology and language specific to your field but also for proper English usage, grammar, punctuation, spelling, verb tense, and phrasing. In addition, AJE's professional editors will make sure the text sounds natural and the sentences are well constructed. Visit their website for more information or to submit a document for their journal editing service.
Receive a 10% discount: enter code 'Landes' into your account to receive your discount.

Author Services by The Charlesworth Group

Author Services from The Charlesworth Group helps researchers to improve the quality, clarity, and readability of their written English and to increase the effectiveness of their manuscripts in communicating the process, findings, and importance of their research. This assistance is suggested either before an article is submitted for peer review or before it is accepted for publication.
 
Visit the Author Services website for more information or to submit a manuscript for their language polishing service.
 

http://www.charlesworthauthorservices.com?rcode=LANDES001

10% Discount: Journal authors can receive a 10% discount by entering code LANDES001 in the referral code box while submitting your manuscript.

Bioedit English Language Editing


http://www.bioedit.co.uk

Bioedit Ltd, an online English editing company, offers unprecedented, high-quality English editing of biomedical texts destined for submission to peer-reviewed journals in the life sciences. The texts are edited by a large, expert team of native English-speaking editors with Ph.D.s and years of experience in a broad range of disciplines in medicine and biology.

  • Editing of the same manuscript by up to three independent editors, including a subject-specific editor and a grammar expert.
  • Tremendous value with no hidden costs.
  • Express editing in less than 48 hours.
  • Secure and confidential.

 

First-time clients will receive a special 20% rebate if they are submitting their work to a Landes Bioscience journal.

 

 

 

Bioscience Editing Solutions provides premier English language editing services for the international community. All of our editors are native English-speaking Ph.D. or M.D. graduates of Ivy League institutions with proven research and publishing success in top-tierjournals. We have the knowledge and experience to prepare your manuscript for competitive submission to any journal.
 
  • 2 independent editors work on your manuscript
  • Editing complete in 2-4 days
  • One low price for all editing and revisions
  • Secure and confidential
  • Native speakers available in several languages
  • 10% discount for submission to any Landes Bioscience journal

 

 

BioScience Writers

BioScience Writers scientific editing and proofreading services

BioScience Writers is a scientific editing company committed to helping authors from the global scientific community maximize the accuracy and impact of their written documents to enhance scientific publication efforts. We provide the highest quality scientific document editing service at a reasonable price with rapid turnaround. All of our editors are native English speakers and Ph.D.- or M.D.-trained scientists who understand the requirements for publishing science, technical, and medical documents. BioScience Writers provides a no-risk guarantee: we will work to ensure you are pleased with every edited document you receive from us, or provide a full refund.  Landes Bioscience Journals authors will receive a 25% discount on their first order! Just include the promotion code 'Landes' via our web site, or when submitting your manuscript by email.

Editage

Editage

Editage, a leading international English editing, writing, and publication service provider, offers multiple-level editing services that check for meaning, punctuation, grammar, sentence construction, logic, structure, and journal formatting. Editage is a preferred brand for non-native English speakers in East Asia.

  • Subject-matter expertise—editors from bioscience disciplines
  • Fast turnaround times—24-hour delivery for emergencies

  • 24/7 online system—manage accounts, track manuscripts, post requests
  • 100% confidentiality
  • Unlimited questions for editor
  • ISO 9001:2000-certified editing processes
  • Free journal formatting
  • Mention “Landes Bioscience” as “Reference” while submitting manuscript and receive a flat 10% discount.

Fresh Eyes Editing

www.fresheyesediting.com

Fresh Eyes Editing specializes in providing high-quality, timely, and confidential editing services to the biomedical community.

Our goal is to help you convey your results in a clear, concise, and logical manner.  Improving the grammar and style of your manuscript will highlight your research, allowing the science to speak for itself.

At Fresh Eyes Editing, we strive to maintain the integrity and meaning of your documents, so it's your writing... perfected.  Contact us today at info@fresheyesediting.com for a free estimate, and mention Landes Bioscience to receive a 10% discount.

Inter-Biotec

Inter-Biotec

Inter-Biotec provides a free online writing course to help biomedical scientists whose first language is not English to write and publish their papers in English-language journals.

International Edit

International Edit

A truly unique service – quality, affordable editing with a personal touch.

  • We are 10 career editors – unlike our competitors, we do NOT send your paper to a freelancer. This ensures careful, consistent, and confidential editing.
  • More than copyediting. A sentence that is perfect grammatically may still not make your point. We work with you to get it right.
  • Have your own personal editor for life – email us about anything, we’re here to help.
  • Free follow-up with every edit.
  • Authors do not pay until after receiving and reviewing their edit.
  • No registration. No hassle. We never have access to any of your personal information.


Mention code 10LN20 for a 20% discount.

Medjaden

Medjaden

Medjaden (美捷登) Bioscience Limited provides professional, customizable and reliable editing, re-writing and writing services for biomedical scientists worldwide, especially those in non-English speaking countries. Our dedicated editing team consists of over 200 world-class professors, scientists, medical doctors, statisticians and language experts. Each manuscript for editing, re-writing or writing will be evaluated prior to service, and then edited by at least two editors and proofread by a language expert, and may go through multiple interactions among our editor(s) and the author if needed to ensure its quality. We continue to pursue our "charge once, serve until publication" policy.
 
Any customers who find us through Landes Bioscience would be automatically eligible for our VIP membership and enjoy a discount of up to 8% and all other VIP privileges. For more information, please visit www.medjaden.com or call +852 81350971.

PI Professional Editing Services
http://www.prof-editing.com/

Write Science Right

http://www.writescienceright.com/

Advertisements